Introduction
Bread
wheat (Triticum aestivum L.) is commonly attacked by three
air-borne fungal pathogens, Puccinia
triticina f. spp. tritici, P. graminis f. spp. tritici and P. striiformis
f. spp. tritici that cause leaf rust,
stem rust and stripe rust diseases, respectively. Leaf rust has a comparatively
wide range of adaptability to climatic conditions and is the most prevalent
among three rust diseases (Riaz et al. 2016). Leaf rust damages
leaves, florets and consequently shriveled seeds, resulting in yield losses up
to 40% (Singh et al. 2016). Stem rust has a preference for hot and humid
climates. Severe stem rust disease epidemics can cause 50 to 70% yield losses
in bread and durum wheat. Similarly, the development of highly virulent stem
rust race Ug99 (TTKSK) in Uganda in 1998 threatened global wheat cultivation
due to its widespread virulence on over 80% of varieties cultivated globally (Yu et al. 2012; Sharma-Poudyal et
al. 2014). European countries
especially Germany and United Kingdom recorded its first major stem rust
outbreak in decades and 80% of UK wheat varieties found susceptible to these
new isolates (Lewis et al. 2018; Olivera et al. 2018). Stripe or yellow rust develops under colder
conditions. Chen (2014) have reported
that yellow rust susceptible varieties losses are more than 60% of potential
yield in the Pacific Northwest. In recent years, highly virulent races of P.
striiformis with adaptation to high temperatures have emerged from
the Himalaya region in Asia, which threaten wheat production in
Indo-Gangetic plains (Hovmøller et al. 2016). In Mexico,
virulence occurred on commercial varieties carrying resistance genes
Yr3, Yr27 and Yr31, resulting
in an epidemic in 2014 (Singh et al. 2016).
The use of chemical fungicides and breeding for genetic resistance are
two fundamental approaches to control wheat rust diseases. Genetic resistance
has always been environment friendly and is particularly inexpensive for wheat
growers in developing countries (Oliver 2014).
There are two common types of genetic resistance; race-specific resistance
based on major genes, and adult plant resistance based on minor genes. Major
genes generally provide resistance at all plant stages, are controlled by
single genes, and can be rapidly overcome by the evolving pathogen population.
On the contrary, minor genes provide resistance at the adult growth stages,
controlled by several minor genes, each with a small effect, thus are
more difficult for the pathogen to overcome. Currently, there is more emphasis
to discover, characterize and utilize minor genes because these genes are
durable and provide rust resistance for a more extended period. Breeding for
adult plant resistance to all three wheat rusts is an important task among
wheat breeders however is quite challenging because of the minor effect
hard to detect in field and complexity of genetic inheritance (Lowe et al.
2011; Vazquez et al. 2015).
Rust resistance genes can be incorporated from wheat genotypes,
landraces and also from relative species of wheat through pre-breeding and
breeding. Synthetic hexaploid wheat (SHW) developed by crossing Triticum turgidum Desf. Husn. (AABB) and
Aegilops tauschii Coss. (DD) holds
genomic diversity for resistance to many abiotic and biotic stresses as
confirmed from evaluation studies of these synthetic wheat germplasm (Ogbonnaya et al.
2013; Börner et al. 2015; Rasheed et al. 2018; Ahmad et al. 2019).
One of the important stripe rust resistance gene Yr24/Yr26 was
introgressed from SHWs and deployed largely in wheat cultivars in China
(McIntosh et al. 2018).
Recently, Zegeye et al. (2014) have reported that SHWs represent rich sources
of new stripe rust resistance which is valuable for future wheat breeding. This
study was focused on the following aims: (1) to evaluate the genetic diversity
for leaf, stem and stripe rust resistance in synthetic hexaploid wheat
accessions at the seedling stage; (2) to identify accessions carrying adult
plant resistance to all three rusts under the field conditions in Queensland,
Australia; (3) to identify sources of potentially durable rust resistance among
synthetic hexaploid wheat.
Materials and Methods
Rust
evaluation
Plant
material and pathotypes: A panel of 200 synthetic hexaploid wheats was
evaluated in this study. Synthetic hexaploid wheat (AABBDD) developed by the
artificial crossing of durum wheat (AABB) and Aegilops tauschii Coss. (DD).
The panel was assessed for disease responses to triple (leaf, stem and
stripe) rust under glasshouse and field conditions available at The University
of Queensland, Australia, during the wheat cropping season of 2018. These SHW accessions were
provided by the Australian Grains Genebank (AGG) in Australia. At the
seedling stage, SHWs were screened using three races of P. triticina [76-1,3,5,7,9,10,12+Lr37, 104 1,3,4,6,7,8,10,12 and
104-1,2,3,(6),(7),11,+Lr24], and one for each P. graminis (34-1,2,7+Sr38) and P.
striiformis (134E16A+17+27+) (Table 1). The selected races
represented highly virulent and prevalent races throughout the wheat-growing
regions of eastern Australia (Wellings 2011; Fetch
et al. 2016).
Evaluation at the seedling stage: The
200 SHW accessions were screened for all three rusts (leaf rust, stem rust and stripe
rust) at the seedling stage under controlled glasshouse
conditions at The
University of Queensland, St Lucia, Queensland, Australia. The seeds of all accessions were imbibed at room
temperature for 24 h and then transferred to 4°C in a refrigerator for 2 days,
and then returned to room temperature for one day. Rust-susceptible stander
cultivar “Morocco” was also planted as a check. Germinating seeds were then
transplanted into ANOVApot®
pots (140 mm) filled with potting media comprised of 70% fines compost of pine
bark (0 to 5 mm) and 30% of coco peat with 5.5 to 6.5 of pH. At the time of
transplanting Osmocote® fertilizer (slow release) was applied at a
rate of 2 grams/pot. Each pot contained four seedling locations (i.e.,
from the pot tag location 1 to 4 clockwise), where every location holds five
sprouted seeds of the same SHW clumped together. Five seedlings of each
SHW entry were grown in non-replicated
augmented design, according to Zegeye et al. (2014). Seedlings were
grown in the glasshouse with a standard day temperature of 25°C for 12 h and 17°C of the night for 12 h under diurnal-conditions,
and temperature fluctuations were ± 2°C. For screening of leaf, stem and stripe rust seedlings,
the batches were planted separately using intervals of one week. Each batch of
seedlings at the two-leaf growth stage was inoculated discretely with
pathotypes mentioned above.
Preserved
urediniospores of leaf rust, stem rust and stripe rust were removed from the -80°C freezer, heat-shocked at 45°C for 3 min. These Puccinia isolates were purified using the single spore method
and increased using the rust susceptible variety “Morocco”. The rust inoculum
was made ready by preparing a suspension of urediniospores in Isopar-6 (mineral
oil) @ 0.005 g/mL. Rust inoculum was applied on the wheat seedling leaves with
a concentration of 6×105 urediniospores/mL by using an IWATA power
jet lite® (air atomizer). After inoculation deionized water was
lightly misted over seedlings and kept in a 100% humid chamber (10°C for stripe rust, and 22°C for leaf rust and stem rust) for 18 h and
humidity was maintained using an electric fogger. After
that, plants
were transferred for disease development to a controlled rust-free glasshouse. Light, temperature and other glasshouse
conditions for triple rust seedling assays were kept according to Hickey et al.
(2012) and Riaz and Hickey (2017).
Rust infection types
(ITs) of leaf and stem rusts were recorded twice: 12- and 16-days
post-infection using the 0–4 scale (Stakman et al. 1962) and stripe rust ITs
were recorded using the 0–9 scale (McNeal et al. 1971). In the case of leaf
rust and stem rust, lower ITs (0–2) were assessed as resistant, and ITs (2+)
were considered moderate, while higher ITs (3–4) were considered susceptible.
Stripe rust seedlings ITs 0–3 were recorded as resistant, 4–6 as moderate
reactions and 7–9 as susceptible, as described by Line and Qayoum (1992). To allow statistical analysis of glasshouse
reactions and to compare disease responses to adult data sets, the seedling
which contains both numbers and symbols were converted to the 1–9 scale
according to Riaz et al. (2016) and Ziems et al. (2014). For mixed rust
ITs, every reading was changed individually to the 1–9 scale, and the means
were obtained.
Rust
evaluation in the field: The same panel of 200 synthetic
hexaploid wheats (SHW) was assessed for leaf rust and stem rust under field
conditions at the Department of Fisheries and Agriculture, Redlands Research
Farm, Queensland, Australia during wheat cropping season 2018. However, stripe
rust evaluation carried out at Gatton Research Farm, Queensland, The University
of Queensland, Australia. Eight seeds of each SHW accessions were planted as
hill plots with two replications. A mixture of rust susceptible genotypes was
planted between each bay to spread inoculum and ensure uniform disease
infection. A set of wheat rust standards, including Thatcher, Thatcher+Lr28, Chinese Spring, Chinese Spring+Sr2, Chara, Chara Mutant, Avocet,
Avocet+Yr17, Avocet+Yr18, Avocet+Yr27, Avocet+Yr29,
Wyalkatchem+Yr29, Lalbhadur,
Lalbhadur+Yr18 and Lalbhadur+Yr29, were planted twice in the
experimental fields to observe the rust epidemic development. Each bay
consisted of two rows of hill plots. After 35 days of
sowing, Morocco plants infected with pathotypes of P. triticina, P. graminis
and P. striiformis, same pathotypes
used in seedling evaluations, were transplanted into the spreader rows to
establish disease in the field experiments. The rust
epidemics were escalated at both experimental sites (Redlands and Gatton) by
using overhead sprinkler irrigations when temperature and humidity were
conducive in the evenings for rust infection. When the triple rust epidemics
had adequately established on rust standards to permit a definite difference
among resistant and susceptible wheat lines, rust responses were scored using
the 1–9 scale, where a genotype reaction score of 1 was recorded very resistant
(VR), 2 resistant (R), 3 resistant to moderately resistant (RMR), 4 moderately
resistant (MR), 5 moderately resistant to moderately susceptible (MRMS), 6
moderately susceptible (MS), 7 moderately susceptible to susceptible (MSS), 8
susceptible (S) and 9 very susceptible (VS) (Bariana
et al. 2007; Jighly et al. 2016). Multiple triple
rust disease responses were recorded from stem elongation to early grain
filling with weekly intervals.
Screening for durable rust resistance genes: Total genomic DNA was extracted from each accession
following previously described protocol by Ain et al. (2015). The presence of
durable resistance genes Lr34/Yr18/Sr57/Pm38, Lr46/Yr29/Sr58/Pm39,
Lr67/Yr46/Sr55/Pm46, and Sr2 were
determined using gene-specific markers by the KASP method using Lr34_TCCIND, Lr46_JF2-2A, CSTM4_67G, and Sr2_ger9_3p markers, respectively (Rasheed
et al. 2016). The Master mix
included 2 μL of 50-100 ng/μL template DNA, 2.5 μL
of 2X KASP master mix, 0.07 μL of KASP assay mix and 2.5 μL
of water. PCR was performed in a 384-well format (S1000, Thermal Cycler, U.S.A.)
by the following procedure: hot start at 95°C for 15 min, followed by 10 touchdown
cycles (95°C for 20 s; touchdown at 65°C initially and decreasing at -1°C per
cycle for 25 s), followed by 30 additional cycles of annealing (95°C for 10 s;
57°C for 60 s). The allele-specific primers were designed
carrying the standard FAM (5′ GAAGGTGACCAAGTTCATGCT 3′) and HEX
(5′ GAAGGTCGGAGTCAACGGATT 3′) tails and with the targeted SNP at
the 3′ end.
Statistical analysis
The basic statistical analysis and frequency
distribution were calculated and visualized using Microsoft Excel 2018. The
multivariate principal component analysis (PCA) was carried out using R version
3.5.2 and PCA biplot was made using ‘ggplot’ function in R v. 3.5.2.
Results
Rust evaluations at the seedling stage
Rust responses at the seedling stage: Of the 200
SHWs, 192 were germinated, and the responses of these to leaf, stem and yellow
rust were assessed at the seedling stage under glasshouse conditions (Fig. 1). In the leaf rust seedling assay, 60 (31%) accessions
showed resistant, 14 (7%) moderately resistant and 106 (55%) showed moderately susceptible to
susceptible responses against the three pathotypes.
Among the resistant accessions, 3 accessions scored very resistant, 24 scored resistant
and 33 accessions scored resistant to moderately resistant responses. The stem rust
seedling assay showed that 131 (68%) SHWs were resistant, 26 (13%) were
moderately resistant and 24 (12%) were susceptible to highly susceptible
against the stem rust pathotype. Among the 131 stem rust-resistant accessions,
15 were recorded very resistant, 16 were found resistant and
100 accessions were identified as resistant to moderately resistant. For stripe
rust, 99 (52%), 50 (26%), 13 (7%) and 30 (15%) SHWs were found resistant,
moderately resistant and moderately
susceptible to susceptible respectively. Of the 99 stripe rust seedling
resistant genotypes, 25 scored highly resistant, 42 recorded resistant and 32
scored resistant to moderately resistant.
Triple rust resistance at the seedling stage in
SHWs: Of the 200 SHWs, ten accessions (SHW-6, SHW-22, SHW-26,
SHW-43, SHW-82, SHW-93, SHW-126, SHW-162, SHW-164 and SHW-190) showed
resistance to all three rusts at the seedling stage based on the responses
recorded with varying degrees of resistant infection types (Table 2). The
accession, SHW-164, showed immunity against leaf rust and stem rust pathotypes
and showed high resistance symptoms against stripe rust pathotype. Similarly,
SHW-6 and SHW-43 showed highly resistant reactions against yellow rust and
displayed very resistant reactions
for leaf and stem rust. According to
our seedling screening results SHW-26, SHW-82, SHW-93, SHW-126 and SHW-162
showed nearly-immune reactions against stripe rust race. Notably, SHW-93
exhibited nearly-immune reactions for all three rust pathotypes. Moreover,
genotypes SHW-82 and SHW-162 showed nearly-immune reactions against P.
triticina and P. striiformis pathotypes.
Table 1: Virulence profile of Puccinia
triticina (Pt), Puccinia graminis (Pgt) and Puccinia striiformis
(Pst) pathotypes used in this study
Pathotypes |
Virulence on genes |
Avirulence on genes |
Pt 76-1,3,5,7,9,10,12 |
Lr13, Lr14a,
Lr15, Lr17a, Lr17b, Lr20, Lr27 and Lr31 |
Lr1, Lr2a, Lr3a, Lr3ka, Lr16, Lr23, Lr24, Lr26, Lr28 and Lr37 |
Pt 104-1,3,4,6,7,8,10,12 +Lr37 |
Lr1, Lr3a, Lr12,
Lr13, Lr14a, Lr15,Lr17a,Lr17b,Lr20,Lr27+31, Lr28 and Lr37 |
Lr2a, Lr3ka, Lr16, Lr23, Lr24
and Lr26 |
Pt 104-1,2,3,(6),(7),11,+ Lr24 |
Lr14a, Lr16, (Lr17a), Lr20, Lr23, Lr24
and (Lr27+ Lr31) |
Lr1, Lr2a, Lr3a, Lr3ka, Lr13, Lr15, Lr17b, Lr26, Lr28 and
Lr37 |
Pgt 34-1,2,7 +Sr38 |
Sr5, Sr6, Sr9g, Sr11, Sr15 and Sr38 |
Sr8a, Sr9b, Sr17, Sr22, Sr24, Sr26, Sr27, SrSatu, Sr30, Sr31 and Sr36 |
Pst 134 E16 A+ 17+ 27+ |
Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr25, Yr27 and YrA |
Yr1, Yr3, Yr4, Yr5, Yr10, Yr15, Yr32, Yr33 YrJ and YrT |
Cereal Rust Report 2018, Plant
Breeding Institute, The University of Sydney, Australia.
Table 2: Triple rust-resistant synthetic hexaploid wheats, their pedigree and disease scores for all three rusts at seedling and adult plant stages
S. No. |
Pedigree |
LR-Adult |
LR-Seedling |
SR- Adult |
SR-Seedling |
YR-Adult |
YR- Seedling |
SHW-6 |
CPI/GEDIZ/3/GOO//JO69/CRA/4/AE.SQUARROSA (409) |
3 |
3 |
3 |
3 |
1 |
1 |
SHW-22 |
CETA/AE.SQUARROSA (1030) |
2 |
2 |
2 |
3 |
3 |
3 |
SHW-26 |
GAN/AE.SQUARROSA
(180) |
3 |
3 |
3 |
3 |
3 |
2 |
SHW-43 |
SCA/AE.SQUARROSA
(518) |
2 |
3 |
2 |
3 |
1 |
1 |
SHW-82 |
DOY1/AE.SQUARROSA (415) |
2 |
2 |
2 |
3 |
3 |
2 |
SHW-93 |
GARZA/BOY//AE.SQUARROSA (520) |
3 |
2 |
1 |
2 |
3 |
2 |
SHW-126 |
ALTAR 84/AE.SQUARROSA (191) |
3 |
3 |
3 |
3 |
2 |
2 |
SHW-162 |
GARZA/BOY//AE.SQUARROSA (307) |
2 |
2 |
2 |
1 |
2 |
2 |
SHW-164 |
68.111/RGB-U//WARD/3/AE.SQUARROSA (322) |
2 |
1 |
1 |
1 |
3 |
3 |
SHW-190 |
68.111/RGB-U//WARD/3/FGO/4/RABI/5/AE.SQUARROSA (629) |
2 |
2 |
3 |
3 |
3 |
3 |
LR= Leaf rust SR=
Stem rust YR= Stripe rust
Fig. 1: Co-efficient of
correlation, histogram and scatterplot of synthetic hexaploid wheats evaluated
against all three rusts at seedling and adult plant stages
Rust evaluations in the field
Fig. 2: Synthetic hexaploid wheats with
adult plant resistance (APR) for leaf rust, stem rust and stripe rust
Fig. 3: Biplot displaying results from principal component analysis (PCA) of rust responses obtained by the synthetic hexaploid wheats (Dim 1 vs. Dim 2 displayed). The color legend describes the accessions resistant to relevant rust disease (LR for leaf rust, YR for stripe rust and SR for stem rust) and ‘S’ represents susceptible accessions
Rust responses at the adult plant stage: Of the 200
SHWs, 187 were assessed against leaf rust, 188 against stem rust and 192
evaluated for stripe rust and rest were anot germinated in the field. In the
field evaluations, the SHW accessions exhibited a wide range of leaf rust, stem
rust and stripe rust response types at the adult plant stage. The
responses ranged from highly resistant to highly susceptible when screened
under high disease pressure of three rust pathotypes (Fig. 1). Leaf rust
adult plant screening showed that 70 (37%) accessions were resistant, 21 (11%)
were moderately resistant and 55 (29%) were susceptible against three-leaf rust
pathotypes in the Redlands field experiment. Among the 70 leaf rust field
resistant SHW accessions, 5 recorded highly resistant, 22 scored resistant and
43 found resistant to moderately resistant. Stem rust field assay showed that
73 (38%) SHWs were resistant, 52 (28%) were moderately resistant and 32 (17%)
were found moderately susceptible to highly susceptible against the stem rust
at the adult stage at Redlands. Among 73 stem rust-resistant accessions at the
adult stage, 11 were highly resistant, 24 were resistant and 38 found resistant
to moderately resistant. Stripe rust adult plant evaluation depicted that 82
(42%), 30 (16%) and 40 (21%) SHWs were resistant, moderately resistant and
susceptible respectively in the Gatton field experiment. Of the 82 yellow rust
adult stage resistant accessions, 18 scored highly resistant, 32 found
resistant and also 32 were resistant to moderately resistant. Stripe rust adult
plant evaluation results exhibited the highest number (82) of resistant SHWs in
the field when compared to leaf rust and stem rust. Adult and seedling
responses of all the rust-resistant SHWs against leaf rust, stem rust, and stripe
rust are given in Table 3.
Table 3: Adult
and seedling responses of rust-resistant SHWs against leaf rust (LR), stem rust
(SR) and stripe rust (YR)
S. No. |
SHW |
LR adult |
LR seedling |
SHW |
SR adult |
SR seedling |
SHW |
YR adult |
YR seedling |
1 |
SWH-4 |
2 |
2 |
SHW-5 |
3 |
3 |
SHW-3 |
2 |
2 |
2 |
SWH-6 |
3 |
3 |
SHW-6 |
3 |
3 |
SHW-4 |
1 |
1 |
3 |
SWH-9 |
3 |
3 |
SHW-8 |
3 |
3 |
SHW-6 |
1 |
1 |
4 |
SWH-11 |
2 |
2 |
SHW-9 |
3 |
3 |
SHW-7 |
2 |
2 |
5 |
SWH-20 |
1 |
2 |
SHW-13 |
3 |
3 |
SHW-8 |
3 |
3 |
6 |
SWH-22 |
2 |
2 |
SHW-19 |
3 |
3 |
SHW-11 |
2 |
2 |
7 |
SWH-26 |
3 |
3 |
SHW-22 |
2 |
3 |
SHW-17 |
1 |
1 |
8 |
SWH-32 |
3 |
3 |
SHW-26 |
3 |
3 |
SHW-18 |
1 |
1 |
9 |
SWH-33 |
2 |
2 |
SHW-28 |
3 |
3 |
SHW-21 |
2 |
2 |
10 |
SWH-34 |
3 |
2 |
SHW-32 |
1 |
1 |
SHW-22 |
3 |
3 |
11 |
SWH-37 |
3 |
3 |
SHW-36 |
2 |
3 |
SHW-26 |
3 |
2 |
12 |
SWH-40 |
2 |
2 |
SHW-40 |
1 |
1 |
SHW-27 |
1 |
1 |
13 |
SWH-43 |
3 |
3 |
SHW-42 |
3 |
3 |
SHW-33 |
3 |
2 |
14 |
SWH-44 |
4 |
3 |
SHW-43 |
2 |
3 |
SHW-36 |
1 |
1 |
15 |
SWH-54 |
3 |
3 |
SHW-52 |
3 |
3 |
SHW-43 |
1 |
1 |
16 |
SWH-57 |
3 |
3 |
SHW-57 |
1 |
1 |
SHW-45 |
1 |
1 |
17 |
SWH-59 |
2 |
2 |
SHW-65 |
3 |
3 |
SHW-63 |
2 |
2 |
18 |
SWH-60 |
2 |
3 |
SHW-67 |
2 |
2 |
SHW-64 |
3 |
3 |
19 |
SWH-62 |
3 |
2 |
SHW-76 |
3 |
3 |
SHW-65 |
2 |
2 |
20 |
SWH-63 |
3 |
3 |
SHW-78 |
3 |
3 |
SHW-66 |
2 |
2 |
21 |
SWH-82 |
2 |
2 |
SHW-79 |
1 |
2 |
SHW-68 |
2 |
2 |
22 |
SWH-88 |
2 |
2 |
SHW-82 |
3 |
3 |
SHW-70 |
2 |
1 |
23 |
SWH-93 |
3 |
2 |
SHW-83 |
1 |
1 |
SHW-71 |
3 |
2 |
24 |
SWH-94 |
3 |
3 |
SHW-93 |
1 |
2 |
SHW-76 |
2 |
2 |
25 |
SWH-104 |
1 |
1 |
SHW-94 |
2 |
2 |
SHW-77 |
1 |
1 |
26 |
SWH-105 |
2 |
2 |
SHW-95 |
1 |
2 |
SHW-78 |
3 |
2 |
27 |
SWH-111 |
3 |
3 |
SHW-98 |
3 |
2 |
SHW-82 |
3 |
2 |
28 |
SWH-113 |
1 |
1 |
SHW-101 |
2 |
3 |
SHW-83 |
2 |
2 |
29 |
SWH-116 |
2 |
2 |
SHW-103 |
2 |
2 |
SHW-84 |
2 |
2 |
30 |
SWH-117 |
3 |
3 |
SHW-105 |
1 |
1 |
SHW-87 |
2 |
2 |
31 |
SWH-120 |
3 |
3 |
SHW-106 |
2 |
3 |
SHW-88 |
3 |
2 |
32 |
SWH-121 |
2 |
2 |
SHW-107 |
2 |
3 |
SHW-89 |
2 |
2 |
33 |
SWH-126 |
3 |
3 |
SHW-108 |
3 |
3 |
SHW-90 |
2 |
2 |
34 |
SWH-127 |
3 |
3 |
SHW-113 |
2 |
2 |
SHW-93 |
3 |
2 |
35 |
SWH-128 |
3 |
2 |
SHW-120 |
3 |
2 |
SHW-96 |
3 |
3 |
36 |
SWH-138 |
3 |
3 |
SHW-121 |
1 |
1 |
SHW-98 |
2 |
1 |
37 |
SWH-140 |
2 |
2 |
SHW-124 |
3 |
3 |
SHW-101 |
2 |
1 |
38 |
SWH-141 |
2 |
2 |
SHW-126 |
3 |
3 |
SHW-102 |
3 |
2 |
39 |
SWH-144 |
3 |
3 |
SHW-128 |
3 |
3 |
SHW-106 |
2 |
2 |
40 |
SWH-145 |
1 |
2 |
SHW-129 |
2 |
3 |
SHW-108 |
2 |
1 |
41 |
SWH-146 |
3 |
3 |
SHW-132 |
3 |
3 |
SHW-110 |
2 |
1 |
42 |
SWH-147 |
3 |
3 |
SHW-136 |
3 |
3 |
SHW-115 |
1 |
1 |
43 |
SWH-151 |
2 |
2 |
SHW-137 |
2 |
3 |
SHW-116 |
3 |
2 |
44 |
SWH-159 |
3 |
3 |
SHW-138 |
1 |
2 |
SHW-122 |
3 |
3 |
45 |
SWH-161 |
1 |
2 |
SHW-141 |
1 |
2 |
SHW-124 |
2 |
2 |
46 |
SWH-162 |
2 |
2 |
SHW-143 |
3 |
3 |
SHW-126 |
2 |
2 |
47 |
SWH-164 |
2 |
1 |
SHW-144 |
2 |
3 |
SHW-129 |
3 |
3 |
48 |
SWH-165 |
2 |
3 |
SHW-145 |
3 |
3 |
SHW-130 |
2 |
2 |
49 |
SWH-174 |
3 |
3 |
SHW-146 |
2 |
3 |
SHW-131 |
2 |
2 |
50 |
SWH-177 |
3 |
3 |
SHW-147 |
2 |
3 |
SHW-134 |
2 |
2 |
51 |
SWH-184 |
2 |
3 |
SHW-148 |
2 |
3 |
SHW-137 |
1 |
1 |
52 |
SWH-186 |
2 |
2 |
SHW-151 |
3 |
2 |
SHW-139 |
3 |
3 |
53 |
SWH-190 |
2 |
2 |
SHW-159 |
3 |
3 |
SHW-140 |
2 |
2 |
54 |
SWH-196 |
3 |
3 |
SHW-162 |
2 |
1 |
SHW-142 |
1 |
1 |
55 |
SWH-197 |
3 |
3 |
SHW-164 |
1 |
1 |
SHW-143 |
2 |
2 |
56 |
|
|
|
SHW-170 |
2 |
1 |
SHW-152 |
3 |
2 |
57 |
|
|
|
SHW-174 |
1 |
1 |
SHW-157 |
2 |
2 |
58 |
SHW-175 |
4 |
3 |
SHW-158 |
2 |
2 |
|||
59 |
SHW-180 |
2 |
1 |
SHW-162 |
2 |
2 |
|||
60 |
SHW-181 |
2 |
3 |
SHW-164 |
3 |
3 |
|||
61 |
SHW-184 |
3 |
3 |
SHW-167 |
1 |
1 |
|||
62 |
SHW-187 |
2 |
2 |
SHW-168 |
2 |
2 |
|||
63 |
SHW-190 |
2 |
3 |
SHW-169 |
1 |
1 |
|||
64 |
SHW-196 |
1 |
3 |
SHW-173 |
2 |
3 |
|||
65 |
SHW-197 |
2 |
2 |
SHW-175 |
1 |
1 |
|||
66 |
SHW-198 |
2 |
1 |
SHW-176 |
1 |
1 |
|||
67 |
SHW-199 |
2 |
3 |
SHW-178 |
2 |
2 |
|||
68 |
SHW-200 |
1 |
1 |
SHW-180 |
3 |
3 |
|||
69 |
SHW-181 |
1 |
1 |
||||||
70 |
SHW-182 |
1 |
1 |
||||||
71 |
SHW-185 |
1 |
1 |
||||||
72 |
SHW-188 |
1 |
1 |
||||||
73 |
SHW-190 |
3 |
3 |
||||||
74 |
SHW-193 |
2 |
2 |
||||||
75 |
SHW-195 |
2 |
2 |
||||||
76 |
SHW-198 |
3 |
3 |
||||||
77 |
SHW-200 |
3 |
2 |
Identification for adult plant resistance: Leaf,
stem and stripe rust adult plant resistance was detected in 24
seedling-susceptible SHW genotypes. Among these genotypes, 20 SHWs carried
resistance against leaf rust, 3 for stem rust and 1 for stripe rust (Fig. 2).
Of these adult plant resistant accessions, 15 were scored susceptible, 7 were
highly susceptible, and 2 scored moderately susceptible to the susceptible
reaction at the seedling stage. Among the adult plant resistant accessions, 2
were considered highly resistant, 13 were resistant to moderately resistant,
and 9 SHWs were moderately resistant with very low rust percent severity in the
field evaluations.
Triple rust resistance at the adult plant stage: Of
these evaluated SHWs, ten (SHW-6, SHW-22, SHW-26, SHW-43, SHW-82, SHW-93,
SHW-126, SHW-162, SHW-164 and SHW-190) exhibited adult plant resistance to all
three rusts scaled between highly resistant to moderately resistant (Table 2).
Genotypes SHW-6 and SHW-43 showed nearly-immune to stripe rust and SHW-93, and
SHW-164 also displayed nearly-immune to stem rust pathotypes. According to our
adult plant screening results, SHW-26 showed resistant reactions against all
triple rust pathotypes. Accession SHW-162 exhibited nearly-immune reactions for
triple rust pathotypes used in this study at the adult plant stage in the
field. Genotypes SHW-43 and SHW-82 both showed nearly-immune infection types against
leaf and stem rust pathotypes in the field at the adult stage.
Coefficient of
correlation and principal component analysis
The response of the SHWs panel to three rusts (leaf, stem
and stripe rust) was assessed at the
seedling stage under glasshouse conditions and at the adult stage at two experimental field sites in Queensland, Australia. The rust responses
at seedling and adult plant stages correlated well with one another (Fig. 1).
The strongest correlations were found between YR-Gatton and YR-Seedling
responses (r= 0.89), followed by
SR-Redlands SR-Seedling responses (r=
0.77). LR-Redlands rust responses exhibited significant and positive correlations with LR-Seedling (r=0.72), SR-Redlands (r= 0.40) and SR-Seedling (r= 0.79). Moreover, LR-Seedling
responses were significantly and positively correlated with SR-Redlands (r= 0.32) and SR-Seedling (r=0.30).
The diversity among SHWs was visualized with
principal component analysis (PCA) based on the rust scores. The first two
principal components explained 72.5% of the total variability (Fig. 3). The
vector position and direction of leaf rust and stem rust was similar and quite
different from the vector position and direction of yellow rust scores. This
indicated the high correlation and similar diversity pattern between leaf rust
and stem rust evaluations.
Durable rust
resistance genes in SHWs
The results revealed that
none of the SHW accessions carried the Sr2 gene. Among the other durable gene complexes, 14
SHWs carried Lr34/Yr18/Sr57/Pm38, and only 3 SHW carried the Lr67/Yr46/Sr55/Pm46 gene. For the Lr46/Yr29/Sr58/Pm39 gene complex, 85 SHWs were found positive and because this gene is yet
to be cloned, the maker is not entirely diagnostic and could have
false-positives.
Discussion
Development
of new wheat cultivars incorporating genetic resistance to rapidly evolving
rust pathogens is essential to sustain food security of wheat growing
countries. The importance of SHW has been repeatedly emphasized for genetic
improvement of wheat for both biotic and abiotic stresses (Ogbonnaya et
al. 2013; Börner et al. 2015;
Rasheed et al. 2018). We
identified SHW accessions carrying several types of resistance against rust
diseases. The SHW carrying triple rust resistance could be exploited in
breeding programs to transfer resistance against all three rusts into
susceptible high yielding wheat varieties. Furthermore, we identified adult
plant resistance to leaf rust, stem rust and stripe rust by efficient
assessment of synthetic wheat germplasm.
The presence of complete and moderate resistance at
the seedling stage in 74 (38%), 157 (81%) and 149 (78%) for leaf rust, stem
rust and stripe rust was quite large in number which indicated that several of
these SHWs have the possibility of the presence of uncharacterized resistance
genes. So far, more than 100 leaf rust resistance genes (Lr) have been designated in bread wheat
and its immediate progenitors (McIntosh et al. 2016). Among these genes,
Lr21 (1DL), Lr22 (2DS), Lr32 (3DS), Lr72
(2BS), Lr40 (1DS), Lr23 (2DS), Lr39 syn. and Lr41
(2DS) have been identified previously in SHWs or derived from Ae. tauschii.
The leaf rust 104-1,2,3, (6), (7),11,
+Lr24 isolate used in this study had
virulence to Lr23, which
indicated that resistant accessions carry an effective alternative gene. The
leaf rust isolates used in this study were virulent to Lr37,
which is derived from Ae. ventricosa through 2NS translocation, and none
of the durum parents of SHWs carried this translocation which ruled out the
possibility of the presence of Lr37 in SHWs (Helguera et al. 2003). Lr1
is a member of a multigene family (PSR567) and encodes a CC-NBS-LRR domain. The
gene is identified in several Ae. tauschii accessions and because leaf rust isolates are
avirulent to this gene, it is likely that SHWs accessions carry this gene
inherited from Ae. tauschii parents (Ling
et al. 2004). The leaf rust isolates were also
avirulent to Lr26/Yr9/Sr31 which is present in all wheat
cultivars with the 1BL.1RS translocation. This translocation is absent in a
wide array of SHWs; however, virulence to this is gene is known among other Puccinia
isolates (Kolmer 2019; Zhang et al. 2019).
Until now, more than 83 stripe rust and 86 stem rust resistance gene
have been designated in wheat and its wild relatives (McIntosh et al. 2016). The stem rust resistance
genes Sr10171 (7DS), Sr10187
(6DS), Sr33 (1DL) and SrTA1662 have been reported in Ae.
tauschii accessions and these could be present in the resistant SHWs. The
stem rust isolate (34-1,2,7+Sr38)
used in this study was avirulent to some genes derived from wild relatives of
bread wheat; hence their presence can be ruled out in SHWs. For example, Sr22
is derived from T. monococcum, Sr23 and Sr26 are derived
from Thinopyrum elongatum, Sr27 and Sr31 are derived from
rye by TRS.3AS and 1BL.1RS translocations, respectively; and Sr36 is
derived from T. timopheevii. However, it is the possibility that
resistant SHWs could carry the Sr30 gene known to be present in several
Australian and Mexican cultivars (McIntosh et al. 2016). Another
important finding was that none of the SHW carries adult plant resistance gene Sr2
associated with pseudo-black chaff, and seedling chlorosis and occurs very
frequently in commercial cultivars produced and distributed by CIMMMYT. Among
the stripe rust resistance genes, Yr28 is derived from SHWs and widely
deployed in synthetic-wheat based commercial cultivars in China (Zeng et al.
2014). Previously, it was identified by GWAS that several stripe rust
resistance loci co-localized with known Yr genes including Yr24/Yr26/Yr28
on chromosome 4DS, Yr48 on chromosome 5AL, Yr32 on chromosome
2AS, and Yr19 on chromosome 5BL (Zegeye et al. 2014). It is expected that
several of the SHWs could carry Yr32 because stripe rust isolate is
avirulent to this gene. Overall, the resistant SHW accessions represent
important sources of new, potentially uncharacterized resistance genes.
The presence of multiple disease resistance in SHWs is an exciting
strategy which is desirable attribute enhancing the breeding value of SHWs. Das et al.
(2016) have evaluated 32 SHWs against leaf rust, fusarium head blight,
spot blotch and Septoria tritici blotch; and identified 7 out of 32 SHWs
resistant to leaf rust. However, the phenotyping was only conducted at the
adult plant stage in the field at CIMMYT. Therefore, it was not possible to
identify the adult plant resistance to leaf rust. Recently, SHWs were
characterized for multiple disease resistance (MDR) by evaluating resistance
against all three rusts, yellow leaf spot, crown rot and Septoria nodorum,
and only 9 out of 322 SHWs were resistant to all six fungal diseases (Jighly et al.
2016). This was quite similar to our results where we identified
10 out of 200 SHWs resistant to all three rusts. Further, it was identified by
genome-wide association studies (GWAS) that one QTL on chromosome 1BL was
associated with resistance to all six fungal pathogens and this QTL was
associated with well-documented gene Lr46/Yr29/Sr58 present in 22% SHWs (Jighly et al.
2016). We identified Lr46/Yr29/Sr58 in 42.5% SHWs which is
significantly higher frequency than previous studies, and likely a result of
using the KASP marker for Lr46/Yr29/Sr58 diagnosis, which is known to
give false-positive results. Similarly, 125 SHWs were evaluated for resistance
against six biotic stresses including three rusts, cereal cyst nematodes, crown
rot and Hessian fly, and only 6 accessions were resistant to combined five
stresses (Bhatta et al. 2019). APR gene Lr67 was only identified in
two SHWs, however the source this gene in SHWs is not clear because previously
none of the Ae. tauschii known to carry Lr67/Yr46/Sr55/Pm46 and gene was evolved after bread wheat polyploidization (Moore et
al. 2015). The Lr67/Yr46/Sr55/Pm46 gene originated from South Asia, and its frequency was pre-dominant in
landraces from South Asia (Riaz et al.
2016).
A high correlation coefficient was observed for leaf rust, stem rust
and stripe rust reactions recorded at the respective seedling and adult plant
growth stages. Thus the glasshouse and field data produced in this assay
represents highly reliable and repeatable data for genetic studies. This also
indicated the presence of both R-genes and adult plant resistance among SHWs. Zegeye et al.
(2014) have reported that 22% of SHWs susceptible at the seedling stage
were resistance to stripe rust at the adult plant stage. In our study, almost
42% of the SHW accessions exhibited resistant to moderately resistant reactions
against stripe rust in the field at the adult plant stage. Of these SHW
resistant accessions, 40% (77) were resistant at both seedling stage indicated
the presence of major resistance gene. The remaining adult plant resistant
accessions could carry adult plant resistance based on minor genes which are
desirable because they provide long-lasting resistance against newly evolving
virulent pathogen races. Similar findings could be implied to the stem
rust-resistant SHW accessions, where three accessions (SHW-29, SHW-31 and
SHW-47) showed seedling susceptibility and resistance at the adult plant stage,
thus were considered to exhibit adult plant resistance.
Based on field results, 24 accessions appeared to carry adult plant
resistance for all three rusts, of which 15 were susceptible, 7 were highly
susceptible, and 2 were recorded moderately susceptible to susceptible at the
seedling stage. The accession SHW-26 SHW-162 displayed near-immune reactions
for all three rust pathotypes at the adult plant stage in Redlands and Gatton
fields. Entries SHW-43 and SHW-82 both exhibited near-immune disease responses
to leaf rust and stem rust races in Redlands field at the adult growth stage.
These SHWs are extremely important to discover minor genes or loci, providing
durable resistance against all three rusts.
Similarly, ten accessions (SHW-6, SHW-22, SHW-26, SHW-43, SHW-82,
SHW-93, SHW-126, SHW-162, SHW-164 and SHW-190) showed triple rust seedling and
adult plant stage resistances simultaneously with varying resistance levels.
These accessions are important sources of major rust resistance genes for all-stage
resistance against all three rusts. The following categories could be
established for multiple rust resistance: a) accession SHW-164 showed immunity
against leaf and stem rust races and highly resistant to stripe race, b) the
accessions SHW-6 and SHW-43 exhibited immunity against stripe rust and showed very resistant reactions for leaf and
stem rust at the seedling stage, c) the accessions SHW-26, SHW-82, SHW-93,
SHW-126 and SHW-162 showed nearly immune responses against stripe rust and
SHW-93 also exhibited same reactions for leaf, stem and stripe rust pathotypes
used in this study, and d) the accessions SHW-82 and SHW-162 showed nearly
immune responses against leaf and stripe rust.
This study
reconfirms the importance of resynthesized hexaploid wheat germplasm to deliver
valuable genetic diversity to develop disease-resistant wheat. As the panel of
SHW accessions displays a spring growth habit, the resistance can be quickly
deployed in elite bread wheat cultivars through repeated cycles of backcrossing
under speed-breeding (Watson et al. 2017; Li et al. 2018). We have started a rust gene discovery
initiative by developing mapping populations derived from all 10 SHWs with
triple rust resistance and progenies are being advanced following speed
breeding protocols. Our findings are also useful for practical breeding because
these SHW accessions with multiple rust resistances can be used to pyramid
multiple rust resistance genes for durable resistance to most devastating
diseases of wheat. This strategy will help not only fast-track isolation of new
rust resistance genes and deploy new resistance genes, but will also broaden
the genetic diversity in breeding germplasm.
Conclusion
Breeding
for rust resistance is crucial for any wheat breeding program. This involves
dynamic rust evaluation and ongoing distribution of new rust-resistant wheat
cultivars. The KASP markers for known rust resistance genes revealed that SHWs
carried leaf rust resistant genes Lr34, Lr46 and Lr67.
This study also revealed that these genotypes carried leaf, stem and stripe
rust resistance. Synthetic hexaploid wheats with substantial genetic diversity for resistance can be effectively
utilized to develop rust-resistant wheat varieties.
Acknowledgements
We acknowledge Higher Education Commission of
Pakistan for IRSIP fellowship grant and we also acknowledge Queensland Alliance
for Agriculture and Food Innovation, University of Queensland, Australia for
providing research facilities.
References
Ahmad MQ, M Hassan, A
Qayyum, MA Saleem, W Malik, E Noor, S Ul-Allah (2019). Characterization of
synthetic wheat germplasm using morphological and molecular markers. Intl J Agric Biol 22:131‒138
Ain QU, A Rasheed, A
Anwar, T Mahmood, M Imtiaz, T Mahmood, X Xia, Z He, UM Quraishi (2015).
Genome-wide association for grain yield under rainfed conditions in historical
wheat cultivars from Pakistan. Front
Plant Sci 6; Article 743
Bariana HS, GN Brown, UK
Bansal, H Miah, GE Standen, M Lu (2007). Breeding triple rust resistant wheat
cultivars for Australia using conventional and marker-assisted selection
technologies. Aust J Agric Res
58:576‒587
Bhatta M, A Morgounov, V
Belamkar, SN Wegulo, AA Dababat, G Erginbas-Orakci, EM Bouhssini, P Gautam, J
Poland, N Akci, L Demir, R Wanyera, SP Baenziger (2019). Genome-wide
association study for multiple biotic stress resistance in synthetic hexaploid
wheat. Intl J Mol Sci 20:1-15
Börner A, FC Ogbonnaya,
MS Röder, A Rasheed, S Periyannan, ES Lagudah (2015). Aegilops tauschii introgressions in wheat. In: Alien Introgression in Wheat,
pp:245‒271. Molnár-Láng M, C
Ceoloni, J Doležel (Eds.). Springer International, New York, USA
Chen XM (2014).
Integration of cultivar resistance and fungicide application for control of
wheat stripe rust. Can J Plant Pathol 36:311‒326
Das MK, G Bai, A
Mujeeb-Kazi, S Rajaram (2016). Genetic diversity among synthetic hexaploid
wheat accessions (Triticum aestivum) with resistance to several fungal
diseases. Genet Resour Crop Evol 63:1285‒1296
Fetch T, T Zegeye, RF
Park, D Hodson, R Wanyera (2016). Detection of wheat stem rust races TTHSK and
PTKTK in the UG99 race group in Kenya in 2014. Plant Dis 100:1495‒1495
Helguera M, IA Khan, J
Kolmer, D Lijavetzky, L Zhong-Qi, J Dubcovsky (2003). PCR assays for the Lr37-Yr17-Sr38
cluster of rust resistance genes and their use to develop isogenic hard red
spring wheat lines. Crop Sci 43:1839‒1847
Hickey LT, PM Wilkinson,
CR Knight, ID Godwin, OY Kravchuk, EAB Aitken, UK Bansal, HS Bariana, IH
DeLacy, MJ Dieters (2012). Rapid phenotyping for adult-plant resistance to
stripe rust in wheat. Plant Breed 131:54‒61
Hovmøller MS, S Walter,
RA Bayles, A Hubbard, K Flath, N Sommerfeldt, M Leconte, P Czembor, J
Rodriguez-Algaba, T Thach, JG Hansen, P Lassen, AF Justesen, S Ali, C
Vallavieille-Pope (2016). Replacement of the European wheat yellow rust
population by new races from the centre of diversity in the near-Himalayan
region. Plant Pathol 65:402‒411
Jighly A, M Alagu, F
Makdis, M Singh, S Singh, LC Emebiri, FC Ogbonnaya (2016). Genomic regions
conferring resistance to multiple fungal pathogens in synthetic hexaploid
wheat. Mol Breed 36; Article 127
Kolmer JA (2019).
Virulence of Puccinia triticina, the wheat leaf rust fungus, in the
United States in 2017. Plant Dis 103:2113‒2120
Lewis CM, A Persoons, DP
Bebber, RN Kigathi, J Maintz, K Findlay, V Bueno-Sancho (2018). Potential for
re-emergence of wheat stem rust in the United Kingdom. Commun Biol 1; Article 13
Li H, A Rasheed, L
Hickey, Z He (2018). Fast-forwarding genetic gain. Trends Plant Sci
23:184‒186
Line RF, A Qayoum (1992).
Virulence, aggressiveness, evolution and
distribution of races of Puccinia
striiformis (the cause of stripe rust of wheat) in North America, pp:
1968‒1987. USDA, Washington DC,
USA
Ling HQ, JW Qiu, RP
Singh, B Keller (2004). Identification and genetic characterization of an Aegilops tauschii ortholog of the wheat
leaf rust disease resistance gene Lr1. Theor Appl Genet 109:1133‒1138
Lowe I, L Jankuloski, SM
Chao, XM Chen, D See, J Dubcovsky (2011). Mapping and validation of QTL which
confer partial resistance to broadly virulent post-2000 North American races of
stripe rust in hexaploid wheat. Theor
Appl Genet 123:143‒157
McIntosh RA, J dubcovksy,
W Rogers, C Morris, R Appels, XC Xia (2016). Catalogue of gene symbols for
wheat. Ann Wheat Newsl 58:1‒18
McIntosh R, M Jingmei, D
Han, Z Kang (2018). Wheat stripe rust resistance gene Yr24/Yr26: A retropspective review. Crop J 6:321‒329
McNeal FH, CF Konzak, EP
Smith, WS Tate, TS Russell (1971). A
uniform System for Recording and Processing Cereal Research Data, Vol. 34,
pp: 121‒143. USDA, Washington DC,
USA
Moore JW, S
Herrera-Foessel, C Lan, W Schnippenkoetter, M Ayliffe, J Huerta-Espino, M
Lillemo, L Viccars, R Milne, S Periyannan, X Kong, W Spielmeyer, M Talbot, H
Bariana, JW Patrick, P Dodds, R Singh, E Lagudah (2015). A recently evolved
hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet
47:1494‒1498
Ogbonnaya FC, O Abdalla,
A Mujeeb-Kazi, GK Alvina, SS Xu, N Gosman, ES Lagudah, D Bonnett, ME Sorrells,
H Tsujimoto (2013). Synthetic hexaploids: harnessing species of the primary
gene pool for wheat improvement. Plant Breed Rev 37:35‒123
Olivera PD, MN Rouse, Y
Jin (2018). Identification of new sources of resistance to wheat stem rust in Aegilops spp. in the tertiary genepool
of wheat. Front Plant Sci 9; Article
1719
Oliver RP (2014). A
reassessment of the risk of rust fungi developing resistance to fungicides. Pest Manage
Sci 70:1641‒1645
Rasheed A, FC Ogbonnaya,
E Lagudah, R Appels, Z He (2018). The goat grass genome’s role in wheat improvement.
Nat Plants 4:56‒58
Rasheed A, W Wen, FM Gao,
S Zhai, H Jin, JD Liu, Q Guo, YJ Zhang, S Dreisigacker, XC Xia, Z He (2016).
Development and validation of KASP assays for functional genes underpinning key
economic traits in wheat. Theor Appl
Genet 129:1843‒1860
Riaz A, LT Hickey (2017).
Rapid phenotyping adult plant resistance to stem rust in wheat grown under
controlled conditions. Meth Mol Biol 1659:183‒196
Riaz A, N Athiyannan, S
Periyannan, O Afanasenko, O Mitrofanova, EAB Aitken, E Lagudah, LT Hickey
(2016). Mining Vavilov’s treasure chest of wheat diversity for adult plant
resistance to Puccinia triticina. Plant
Dis 101:317‒323
Sharma-Poudyal D, XM
Chen, RA Rupp (2014). Potential oversummering and overwintering regions for the
wheat stripe rust pathogen in the contiguous United States. Intl
J Biometeorol 58:987‒997
Singh RP, PK Singh, J
Rutkoski, DP Hodson, X He, LN Jørgensen, MS Hovmøller, J Huerta-Espino (2016).
Disease Impact on Wheat Yield Potential and Prospects of Genetic Control. Annu Rev Phytopathol 54:303‒322
Stakman EC, DM Stewart,
WQ Loegering (1962). Identification of
physiologic races of Puccinia graminis var. tritici. USDA, Washington DC, USA
Vazquez MD, R Zemetra, CJ Peterson, XM Chen, A
Heesacker, CC Mundt (2015). Multi-location wheat stripe rust QTL analysis:
genetic background and epistatic interactions. Theor Appl Genet 128:1307‒1318
Watson A, S Ghosh, M
Williams, WS Cuddy, J Simmonds, MD Rey, MAM Hatta, A Hinchliffe, A Steed, D
Reynolds, N Adamski, A Breakspear, A Korolev, T Rayner, LE Dixon, A Riaz, W
Martin, M Ryan, D Edwards, J Batley, H Raman, C Rogers, C Domoney, G Moore, W
Harwood, P Nicholson, MJ Dieters, IH DeLacy, J Zhou, C Uauy, SA Boden, RF Park,
BBH Wulff, LT Hickey (2017). Speed breeding is a powerful tool to accelerate
crop research and breeding. Nat Plants
4:23‒29
Wellings CR (2011).
Global status of stripe rust: a review of historical and current threats. Euphytica 179:129‒141
Yu LX, A Morgounov, R
Wanyera, M Keser, SK Singh, M Sorrells (2012). Identification of Ug99 stem rust
resistance loci in winter wheat germplasm using genome-wide association
analysis. Theor Appl Genet 125:749‒758
Zegeye H, A Rasheed, F
Makdis, A Badebo, FC Ogbonnaya (2014). Genome-wide association mapping for
seedling and adult plant resistance to stripe rust in synthetic hexaploid
wheat. PLoS One 9; Article e105593
Zeng QD, DJ Han, QL Wang,
FP Yuan, JH Wu, L Zhang, XJ Wang, LL Huang, XM Chen, ZS Kang (2014). Stripe
rust resistance and genes in Chinese wheat cultivars and breeding lines. Euphytica 196:271‒284
Zhang L, C Shi, Q Meng, H
Yan, D Liu (2019). Race and virulence analysis of Puccinia triticina in China in 2014 and 2015. Plant Dis 104:455-464
Ziems LA, LT Hickey, CH
Hunt, ES Mace, GJ Platz, JD Franckowiak, DR Jordan (2014). Association mapping
of resistance to Puccinia hordei in
Australian barley breeding germplasm. Theor
Appl Genet 127:1199‒1212